Modeling of Biomolecular Systems Interactions, Dynamics, and Allostery: Bridging Experiments and Computations - September 10-14, 2014, Istanbul, Turkey

Modeling of Biomolecular Systems Interactions, Dynamics, and Allostery Poster Session II

54-POS Board 7 Intrinsic Variations in the Structure of Spacer Regions Can Critically Influence Transcription Arvind Marathe, Prasun Kumar , Manju Bansal. Indian Institute of Science, Bangalore, India. TraR of Agrobacterium tumefaciens is a member of the LuxR family of transcriptional regulators, which regulates genes that control vegetative replication and conjugal transfer of the tumour-inducing (Ti) plasmid. It exists as a dimer in the solution with each monomer comprising of 234 residues. TraR is activated only when the N-terminal domain of each monomer binds to an autoinducer molecule and C-terminal domain binds to specific DNA sequences (traboxes) of the target promoters. In this study, we have carried out extensive (60 ns) molecular dynamics simulations of a free wild-type trabox d(GATGTGCAGATCTGCACATC), the same sequence with double mutation (G9→C and C12→G) in the spacer region, which eliminates transcription, a TraR-trabox complex (PDB ID: 1L3L) and unbound TraR. Structural variations in the dinucleotide step parameters, primarily slide and roll, dictate the binding of traR protein to the trabox. Mutations affect the groove width and the overall conformation of the trabox by introducing kinks in the spacer region, possibly making it unfavourable for binding to traR monomer/dimer. Principal component analysis of motion of each monomer of bound and unbound TraR shows that each monomer tend to have different conformations. Our analysis shows that TraR selects a suitably positioned trabox, and that the wild-type trabox is far more likely to assume such a suitable conformation as compared to the mutated trabox. This study highlights the influence on protein binding, of the intrinsic structural variations in regions of DNA that do not directly hydrogen bond to the protein.

109